Phenotypic similarity of spheroids of native chondrocytes and spheroids of chondrocytes differentiated from human induced pluripotent stem cells using recombinant factors TGF-β1 and BMP2

Full Text

Introduction

Hyaline cartilage is continuously exposed to mechanical stress and is therefore prone to damage caused by injury, inflammation, or age-related degeneration. Owing to its avascular nature and inherently limited regenerative capacity, hyaline cartilage exhibits poor spontaneous healing, which underscores the growing importance of regenerative medicine approaches for the restoration of its structural and functional integrity. [1]. Regenerative medicine comprises several cell therapy-based approaches, such as matrix-associated autologous chondrocyte implantation (MACI), which was approved by the Food and Drug Administration (FDA) in 2016. During MACI, a sample of healthy cartilage is procured, from which chondrocytes are isolated, grown in vitro, and transplanted to the joint defect site on a specialized membrane [2]. Despite proven clinical efficacy, MACI has a number of drawbacks, including invasive sampling, limited amount of cartilage obtained via biopsy, low proliferative capacity of cells, and gradual loss of chondrocyte phenotype with each passage in two-dimensional (2D) cell cultures. These problems with 2D chondrocyte cultures can be partially solved by using 3D cultures. For example, 3D spheroid cultures of chondrocytes of various origins have a lower degree of differentiation and higher levels of hyaline cartilage markers [3].

3D cell cultures, including chondrocytes, have been evolving for a long time and hold great promise in both fundamental medical research and regenerative medicine [4, 5]. Spheroid cultures of autologous chondrocytes can be used for the treatment of cartilage degradation [6]. Spheroid cultures have improved proliferative capacity while preserving the phenotype and functional activity of cells, as well as expression of key chondrocytic genes [7, 8]. 3D cultures of chondrocytes mimic mesenchymal condensation during early cartilage development [9, 10]. Spheroid cultures can be obtained in a variety of ways, such as the hanging drop method [11], centrifuging a cell suspension with a specified density [12], self-assembly of spheroids in suspension cultures [13], culturing in U-bottom microplates [14], and methods involving various biomaterials [15]. The resulting 3D cell aggregates can be effectively grown in vitro under dynamic conditions, for example, in an orbital shaker [16].

In certain cases, such as long-term therapy with some non-steroidal anti-inflammatory drugs or glucocorticoids, as well as chemotherapy or radiotherapy, the regenerative potential of cartilage can be almost completely lost [17]. The loss of regenerative potential makes it impossible to obtain autologous cells, preventing the use of some cell therapy-based approaches for repairing cartilage defects.

Mesenchymal stromal cells (MSCs) are an important cell source for cartilage repair. These cells can differentiate into chondrocytes; moreover, they have immunomodulatory properties and low immunogenicity, and release a variety of bioactive molecules, such as cytokines, chemokines, glycoproteins, and growth factors. MSCs are sufficiently safe, with no reported serious side effects. MSCs introduced by an intra-articular injection or arthroscopic implantation can considerably reduce pain and improve joint function [18]. However, the high heterogeneity of MSCs, even when derived from the same tissue type, along with the risk of ossification and short-term homing in the damaged tissue, necessitate comprehensive studies on the potential of these cells and improved MSC-based therapies [19].

Spheroid cultures of chondrocytes derived from induced pluripotent stem cells (iPSCs) are another promising alternative to donor tissue-derived chondrocytes [20]. The advantages of iPSCs are primarily associated with their unlimited self-renewal capacity and the ability to differentiate into a wide range of cell types; moreover, their production does not require complex, painful surgical procedures. Chondrocytes derived from iPSCs are not always completely mature. Differences in their ability to produce cartilage-specific components of the extracellular matrix (ECM), such as type II collagen and aggrecan, are frequently observed, even when using the same differentiation protocol. We used an iPSC differentiation protocol [21] that mimics the natural cartilage development, including mesoderm induction by small molecules and chondrogenic differentiation mediated by recombinant factors TGF-β1 (transforming growth factor beta 1) and BMP2 (bone morphogenetic protein 2), with subsequent maturation in a 3D culture in vitro.

The work aimed to compare the phenotypes of spheroid cultures of native chondrocytes and chondrocytes derived from human iPSCs.

Methods

Pluripotent Stem Cell Culture

The IPSRG4S (UEF-3B) iPSC line was obtained from fibroblasts of a healthy donor (male, 60 years old). Reprogramming was performed by fibroblast transduction with Sendai virus, which contained pluripotency factor genes KLF4, MYC, SOX2, and POU5F1 [22]. iPSCs were grown in 6-well plates with Matrigel matrix (Corning, USA) (Fig. 1, a). The culture medium was a combination of TeSR-1 (STEMCELL Technology, Canada) and Gibris 8 (PanEco, Russia) media at a ratio of 1:3, with 100 U/mL penicillin/streptomycin solution (PanEco, Russia). Passages began at a confluent cell monolayer density of 80%. Cells were plated at a concentration of 50–75 thousand cells per 1 cm². For this purpose, iPSCs were transferred on a medium containing 10 μM Rho kinase inhibitor Y27632 (Miltenyi Biotec, Germany) 2–3 h prior to passage. Cells were washed with Hanks’ balanced salt solution (PanEco, Russia) and incubated at 37 °C with 0.05% trypsin solution. Trypsin was inactivated using a double volume of Dulbecco’s modified Eagle’s medium (DMEM) (PanEco, Russia) with 10% fetal bovine serum (FBS) (HyMedia, India). The cell suspension was centrifuged at 200g for 5 min. The supernatant was collected, and cells were resuspended in iPSC culture medium. To improve the survival of iPSCs, 10 μM Rho kinase inhibitor Y27632 (Miltenyi Biotec, Germany) was added to the medium. After 12 h, the medium was replaced with a similar medium without the Rho kinase inhibitor.

 

Fig. 1. Scheme of the protocol for the production of spheroids of chondrocytes differentiated from induced pluripotent stem cells (iPSC) line IPSRG4S: a — initially, iPSCs are cultured on commercial media for pluripotent stem cells until cells reach 80% confluency; b — at the next stage for induction of differentiation in the chondrocytic direction iPSCs are cultured on medium A for 2 days, then the medium is changed and cultured in medium without Chir 99021 and Rho kinase inhibitor Y27632 for the next 6 days, changing the medium every 2 days; c — then cells are transferred to medium B to facilitate chondrogenesis for the next 10 days of cultivation; d — sufficient number of cells is generated to start the spheroids production stage (e) and the cells are aggregated into spheroids in low-adhesive conditions under gravity; f — obtained spheroids are cultured in mini-bioreactors in medium B.

 

Chondrogenic Differentiation of Induced Pluripotent Stem Cells

To induce mesodermal differentiation, iPSCs were grown in Medium A for the first two days (Table 1, Medium A components). On day 3, once the mesoderm formed, chondrogenic differentiation was induced by replacing the medium with a fresh Medium A without Chir 99021 and Rho kinase inhibitor Y27632. All other components that stimulated the transformation of mesodermal cells into chondrogenic precursor cells remained unchanged. The medium was replaced every two days for 3–9 days (Fig. 1, b).

On day 10, a chondrocyte-like cell culture formed, and medium B was used to promote cell maturation and maintain the chondrocyte phenotype (Table 1, Medium B components). The medium was replaced every two days for 10 days (Fig. 1, c). After 12 days of cell culture on Medium B, we began growing the required number of cells for spheroid formation. For this purpose, cells were collected from a 6-well plate using 0.05% trypsin solution, transferred to a 15 mL tube containing DMEM and 10% FBS, and centrifuged at 200g for 5 min. The supernatant was discarded, and cells were suspended in 1 mL of medium B and transferred to a 75 cm² culture flask containing 0.1% gelatin solution (Fig. 1, d). Spheroid formation started when the confluent cell monolayer density reached 80% (approximately 1.5–2.0 million chondrocytes or iPSC-derived chondrocytes per a 75 cm² culture flask). For this purpose, cells were collected using 0.05% trypsin solution and resuspended in medium B.

 

Table 1. Composition of media used for the differentiation of induced pluripotent stem cells into chondrocytes

Medium A components	Concentration
Advanced DMEM/F12	90%
L-alanyl-l-glutamine	2 mM
Penicillin/streptomycin solution	100 U/mL
Fetal bovine serum	10%
Insulin-transferrin-selenite	Insulin: 10 µg/mL Transferrin: 5.5 µg/mL Selenite: 5 ng/mL
β-mercaptoethanol	90 mM
Ascorbic acid	50 µg/mL
CHIR99021	10 µМ
Rho kinase inhibitor Y27632	10 µМ
Retinoic acid	10 nМ
B-27	2%
Medium B components	Концентрация
Advanced DMEM/F12	90%
L-alanyl-l-glutamine	2 mM
Penicillin/streptomycin solution	100 U/mL
Fetal bovine serum	10%
Insulin-transferrin-selenite	Insulin: 10 µg/mL Transferrin: 5.5 µg/mL Selenite: 5 ng/mL
Ascorbic acid	50 µg/mL
BMP2	10 ng/mL
TGF-β1	10 ng/mL

 

Spheroid Formation

The day before the spheroid formation stage, a 96-well plate was prepared by adding 75 µL of 1.5% agarose (PanEco, Russia) prepared using distilled water to each well. Agarose was melted in a microwave oven at 700 W and brought to the boil for 60–90 s. Each well received 75 µL of melted agarose, which was then allowed to solidify at room temperature for 15 min. Following that, 150 µL of DMEM were added to each well with agarose, and the plate was placed in a CO₂ incubator for at least 12 h.

Following agarose polymerization, native or iPSC-derived chondrocytes were collected using 0.25% trypsin solution, transferred to a 15 mL tube containing DMEM and 10% FBS, and centrifuged at 200g for 5 min. The supernatant was discarded, and cells were resuspended in 1 mL of Medium B and transferred to 96-well plates with 1.5% agarose. The formation of a single spheroid requires 100,000 cells. Cells were grown in a 96-well plate with 1.5% agarose for 1–3 days in Medium B, with 150 µL of complete medium per well (Fig. 2, a), until spheroid formation was observed (Fig. 2, b). Spheroids were transferred from wells to a tube using a 1 mL tip or a 3 mL Pasteur pipette. Spheroids were allowed to settle for 2–3 min, and the supernatant was collected. Spheroids were placed in a freshly thawed, undiluted Matrigel matrix (Corning, USA) at 4 °C. After 30 min, spheroid sediment obtained by passive sedimentation in a 15 mL tube or centrifugation at 100g for 1 min was collected. Spheroids were transferred to mini bioreactors, and 6 mL of Medium B were added. The mini bioreactor production technique is described in our previous work [23]. Mini bioreactors were then placed on an orbital shaker in a CO₂ incubator. The parameters were as follows: temperature 37 °C, CO₂ concentration 5%, moisture 100%, agitation speed 70–75 rpm (Fig. 1, f). The medium was replaced once a week, based on evaporation or as needed, taking into account the acid-base indicator color; passive sedimentation was used, with no centrifugation.

 

Fig. 2. Process of spheroid formation chondrocytes differentiated from induced pluripotent stem cells line IPSRG4S in the wells of a 96-well plate: a — the beginning of spheroid formation; b — the formed spheroid on day 2 of cultivation. The scale bar size is 200 µm.

 

Native Chondrocyte Isolation and Culture

Chondrocytes were isolated from non-load bearing cartilage regions in patients after total knee replacement. Primary chondrocyte cultures were obtained from a total of 17 patients. Three cell cultures were then randomly selected for further analysis. All samples were collected aseptically and stored in sterile tubes containing DMEM with 200 U/mL penicillin/streptomycin solution (PanEco, Russia). Cartilage samples were kept refrigerated at 2–8 °C until use. Enzyme treatment began no later than 2 days after sampling. Cartilage samples were washed with Hanks’ balanced salt solution (PanEco, Russia). The samples were then cut into 1–2 mm fragments using a sterile scalpel and pincers. The resulting tissue fragments were placed into 15 mL tubes, and 2–5 mL of 0.01% collagenase type II (Worthington Biochemical, USA) solution in DMEM were added. Enzyme treatment was performed at 37 °C for 8–12 h, with constant stirring at 150–200 rpm. The enzyme solution was removed by adding an equivalent volume of clean DMEM to a tube containing cartilage fragments and centrifuging at 300g for 10 min. The supernatant was discarded. The residue, including cartilage fragments, was resuspended in chondrocyte culture medium. This medium consisted of a basal medium Advanced DMEM/F12 (Thermo Fisher Scientific, USA) with 10% FBS, 2 mM L-alanyl-L-glutamine solution (Thermo Fisher Scientific, USA), and 100 U/mL penicillin/streptomycin solution (PanEco, Russia). Cells were then placed into cell adhesion culture flasks containing 0.1% gelatin solution (PanEco, Russia). For passaging, culture flasks with chondrocytes were washed with Hanks’ balanced salt solution (PanEco, Russia). A 1:1 mixture of 0.25% trypsin solution and Versene solution (PanEco, Russia) was then added, and the flasks were incubated at 37 °C for 5 min. Trypsin was inactivated using a double volume of DMEM with 10% FBS. Chondrocytes were then resuspended in chondrocyte culture medium and plated at a concentration of 20–30 thousand cells per 1 cm².

Reverse Transcription Polymerase Chain Reaction

Reverse transcription polymerase chain reaction (RT-PCR) was used to assess the expression of chondrocyte genes. For this purpose, 1 million cells (approximately 10–15 spheroids) were lysed in an RLT buffer (QIAGEN, Germany), and RNA was isolated using RNeasy Plus Mini Kit (QIAGEN, Germany) according to the manufacturer’s protocol. RNA concentrations in samples were measured in a nucleic acid assay microplate using an Infinite 200 Pro plate reader (Tecan, Switzerland). The MMLV RT kit (Evrogen, Russia) was used for complementary DNA (cDNA) synthesis, according to the manufacturer’s protocol. RT-PCR was performed using a master mix that contained 5 µL of 5× qPCRmix-HS SYBR (Evrogen, Russia), 0.8 µL of 10 mM forward and reverse primers (Table 2), 18.2 µL of water, and 1 µL of cDNA matrix. A CFX96 RT-PCR system (Bio-Rad, USA) was used. The gene YWHAZ, which encodes tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, was used as a reference gene. Each biological replicate included three technical replicates. The findings were analyzed in Microsoft Excel (Microsoft, USA) using ΔΔCt [24].

 

Table 2. Primers for the measurement of the expression level of chondrocyte genes

Gene	Primers used in the study, 5’-3’	Product size, bp
ACAN	F: AGGAGTCCCTGACCTGGTTT R: CCTGACAGATCTGCCTCTCC	167
COL1A2	F: AGGGTGAGACAGGCGAACA R: CCGTTGAGTCCATCTTTGC	184
COL2A1	F: TGGACGCCATGAAGGTTTTCT R: CCATTGATGGTTTCTCCAAACC	142
SOX9	F: GAAGTCGGTGAAGAACGGGC R: CACGTCGCGGAAGTCGATAG	283
YWHAZ	F: ACTTTTGGTACATTGTGGCTTCAA R: CCGCCAGGACAAACCAGTAT	94

 

Statistical Analysis of Reverse Transcription Polymerase Chain Reaction Findings

Statistical analysis was performed using GraphPad Prism 10 (GraphPad Software, Inc., USA). The Shapiro–Wilk test was used for normality testing. One-way analysis of variance (ANOVA) with Tukey’s multiple comparison test was used for comparisons. Intergroup differences were considered significant at р < 0.05.

Assessment of Chondrocyte Gene Expression Using Immunocytochemistry

Monolayer cultures were fixed in 10% buffered formalin (Syntacon, Russia) for 15 min, washed with 0.01 M phosphate-buffered saline (PBS) three times, and incubated in 0.1% Triton-X100 solution (Sigma-Aldrich, USA) for 20 min. Following permeabilization, samples were incubated in 0.01 M PBS-based blocking buffer (PanEco, Russia) with 3% goat serum and 0.1% Tween 20 (Sigma-Aldrich, USA) for 30 min. The samples were then stained with primary antibodies to aggrecan (mouse, 1:500), type I collagen (rabbit, 1:800), and SOX9 (rabbit, 1:400) (Invitrogen, USA), as well as type II collagen (rabbit, 1:200) (Abcam, UK). Samples were incubated with a blocking solution containing primary antibodies for 1.5 h at room temperature. Cell cultures were then washed with 0.01 M PBS three times. Alexa Fluor 555 (goat, anti-rabbit, 1:500) and Alexa Fluor 546 (goat, anti-human, 1:500) (Invitrogen, USA) were used for secondary antibody staining. Staining was performed for 1 h under darkroom conditions. Cell cultures were then washed with 0.01 M PBS three times. Nuclear staining was performed using 100 ng/mL DAPI (Sigma-Aldrich, USA). After 15 min of staining, the cultures were washed three times with 0.01 M PBS (Sigma-Aldrich, USA). Stained preparations were analyzed using an Olympus IX53F fluorescence microscope (Olympus, Japan). The CellSens Standard software (Olympus, Japan) was used for image analysis. Spheroid cultures were fixed in 10% buffered formalin (Syntacon, Russia) for 30 min and then washed with 0.01 M PBS three times. Spheroids were immersed in tissue freezing medium (Leica Microsystems, Germany), incubated at 4 °C for 1 h, and frozen in liquid nitrogen vapor, and 7 µm sections were prepared using Cryotome™ FSE (Thermo Fisher Scientific, USA). Immunocytochemistry was then performed according to a protocol for monolayer cultures, starting with the permeabilization stage.

Results

In this work, we compared the phenotypes of spheroid cultures of native chondrocytes and chondrocytes derived from iPSCs by targeted differentiation. To induce iPSC differentiation to mesodermal cells and subsequent formation of chondrocyte precursors, iPSCs were grown in Medium A, which contained CHIR99021, retinoic acid, and ascorbic acid. In the next stage, recombinant growth factors BMP2 and TGF-β1 were added to medium B to enhance differentiation of progenitor cells into chondrocytes. To support long-term cell growth and morphogenesis, spheroids were formed from the resulting iPSC-derived chondrocytes and grown in 3D cultures using mini bioreactors in a medium containing recombinant factors BMP2 and TGF-β1 (Fig. 3). Immunocytochemistry revealed that iPSC differentiation into chondrocytes in a medium containing 10 ng/mL BMP2 and 10 ng/mL TGF-β1 produced cells with the chondrocyte phenotype and expression of chondrocyte-specific genes (ACAN, COL2A1, and SOX9) similar to that of native chondrocytes derived from patient’s cartilage. Already 19 days after the start of the protocol, 2D cultures of iPSC-derived chondrocytes showed high expression of these markers, comparable with native chondrocytes (Fig. 2).

 

Fig. 3. Immunocytochemical analysis of chondrocytes obtained from different sources. Induced pluripotent stem cells (iPSC) chondrocyte derivates obtained by day 19 from the start of differentiation show similar levels of expression of major chondrocyte marker genes: e — ACAN; f — COL1A2; g — COL2A1; h — SOX9 compared to native chondrocyte culture at passage 2: a — ACAN; b — COL1A2; c — COL2A1; d — SOX9. The culture of iPSCs was taken as a negative control: i — ACAN; j — COL1A1; k — COL2A1; l — SOX9. The scale bar size is 200 µm.

 

During two months of culture, spheroids showed stable growth, reaching 3–4 mm in diameter, which indicated favorable conditions for cell interactions, proliferation, and ECM synthesis in both iPSC-derived (Fig. 4, e) and native chondrocytes (Fig. 4, j). After two months of culture, 99% of iPSC-derived chondrocytes showed high expression of primary chondrocyte genes (ACAN, COL2A1, and SOX9), as evidenced by immunocytochemistry (Fig. 4) and RT-PCR (Fig. 5) findings. Gene expression levels calculated by ΔΔCt were comparable with those of mature native chondrocytes. This indicates that iPSC-derived chondrocytes are capable of forming hyaline-like cartilage (Fig. 5). However, despite promising differentiation results, iPSC-derived chondrocytes showed a significant increase in COL1A2 expression compared to native chondrocytes, indicating the presence of cells characteristic of fibrous cartilage (Fig. 5). There were no significant differences in the expression of ACAN, COL2A1, and SOX9 between iPSC-derived and native chondrocytes; however, it was significantly higher in undifferentiated iPSCs.

 

Fig. 4. Immunocytochemical analysis of spheroid generated from chondrocytes different sources. ICC analysis was performed at day 30 from the start of differentiation when the spheroids were at the stage of culturing in mini-bioreactors. The expression of aggrecan and collagen II type in spheroid samples from native chondrocytes (a — ACAN; c — COL2A1) and spheroid of chondrocytes differentiated from induced pluripotent stem cells (iPSC) (f — ACAN; h — COL2A1) is at a similar level. However, spheroids of chondrocytes differentiated from iPSCs (g — COL1A1; i — SOX9), as compared to native chondrocytes (b — COL1A1; d — SOX9), are characterised by higher expression levels of collagen I type and SOX9. Morphology of spheroids generated from native chondrocytes (e) and spheroids of chondrocytes differentiated from iPSCs (j) at the stage of cultivation in mini-bioreactors. The scale bar size is 100 µm.

 

Fig. 5. Results of relative normalized chondrocyte gene expression analysis in spheroids from chondrocytes differentiated from induced pluripotent stem cells (iPSC) (1 biological replicate) and spheroids of native chondrocytes (3 biological replicates). IPSC spheroids (1 biological repeat) were taken as a negative control. The expression levels of the chondrocytic genes ACAN, COL2A1, and SOX9 are significantly higher in spheroids formed from chondrocytes differentiated from iPSCs and in spheroids of native chondrocytes compared to the control group of iPSCs. This result indicates successful differentiation of iPSCs toward the chondrocytic lineage. However, a significant increase in COL1A2 gene expression was observed in the spheroids of chondrocytes differentiated from iPSCs compared to spheroids of native chondrocytes, suggesting the presence of chondrocytes with characteristics of fibrous cartilage. The graphs indicate the statistical significance of differences according to Tukey’s test: ** p ≤0,01, *** p ≤0,001, **** p ≤0,0001.

 

Discussion

Functionally, native chondrocytes are completely mature cells that retain the specific properties of the cartilage from which they were derived after differentiation and in vitro culture (such as hyaline, fibrous, or elastic cartilage). Native chondrocytes typically produce more ECM. Chondrocyte isolation from patient’s cartilage is a relatively simple procedure; however, it can be limited by the availability of donor tissues, the need for surgical interventions, and the difficulties associated with maintaining the chondrocyte phenotype in vitro. Isolation of iPSCs and their differentiation into chondrocytes, particularly ensuring the high quality of functional cells, are even more complex and costly procedures [25]. However, iPSC-based techniques enable the scaling of cell production and ensure the flexibility of tissue engineering in patients with reduced proliferative capacity of native chondrocytes [26].

In the beginning of our protocol, Medium A enabled the differentiation of iPSCs into mesodermal cells, as well as the formation of chondrocyte progenitor cells. Medium A contained a small molecule CHIR99021. This molecule specifically inhibits kinase GSK-3, resulting in ß-catenin buildup in the nucleus and activating the Wnt/ß-catenin signaling pathway, which regulated mesoderm formation during embryogenesis in mammals [27]. Moreover, Medium A contained retinoic acid, which enhances mesenchymal condensation and regulates gene expression of cartilage ECM [28], and ascorbic acid, which is required for collagen biosynthesis and maturation [29].

Medium B contained recombinant growth factors BMP2 and TGF-β1 to facilitate chondrogenesis. These factors activate the SMAD signaling pathway, promoting the expression of the gene SOX9, which directly regulates the ACAN and COL2A1 genes [30]. This combination of culture media mimics natural cartilage development, significantly improving the effectiveness of chondrogenic differentiation.

3D chondrocyte cultures in mini bioreactors were essential for optimal cell proliferation. The observed stable growth of spheroid cultures of iPSC-derived chondrocytes and the increase in their diameter to 3–4 mm during two months of culture indicate that these conditions favor proliferation while having no negative effect on cell differentiation. Moreover, this diameter of spheroids facilitates effective metabolite supply, supporting cellular activity and the synthesis of ECM components. After two months of culture, the immunophenotypes of spheroid cultures of iPSC-derived and native chondrocytes were comparable. The ability to maintain a stable chondrocyte phenotype and high activity of type II collagen and proteoglycan synthesis promote the formation of strong, elastic cartilage that is resistant to mechanical loads (Fig. 4). However, of note is increased COL1A2 expression in iPSC-derived chondrocytes compared to native chondrocytes, indicating that the former spheroids contain structures typical of both hyaline and fibrous cartilage (Fig. 5). This may result from the use of serum that, according to some research, may have a fibrotic effect, increasing the synthesis of type I collagen [31].

Overall, our findings support the use of iPSCs for obtaining spheroid cultures of functionally mature chondrocytes that can maintain the chondrocyte phenotype during long-term culture. High expression of key chondrocyte genes and stable growth of spheroid cultures of iPSC-derived chondrocytes make them a promising option for transplantation in regenerative medicine.

Conclusion

This work demonstrates that iPSC differentiation into chondrocytes, followed by the formation of 3D spheroid cultures, is a promising approach to producing cells suitable for transplantation and repair of damaged joints. Recombinant factors such as TGF-β1 and BMP2 effectively induce the expression of key chondrocyte genes (ACAN, COL2A1, and SOX9), confirming the maturity and functionality of the resulting chondrocytes. Stable expression of chondrocyte genes in long-term culture in mini bioreactors indicates the stability of cell phenotype and high quality of ECM synthesis. Importantly, iPSC-derived chondrocytes are phenotypically similar to native chondrocytes and capable of forming hyaline-like cartilage, which is suitable for load-bearing joints. Our findings confirm that iPSCs can be used to produce chondrocytes that are phenotypically similar to mature hyaline cartilage cells and can be used in the treatment of joint disorders.

Additional information

Authors' contributions. P.A. Golubinskaya — 2D cell cultures cultivation, iPSCs differentiation, literature review, collection and analysis of literature sources, writing the text and editing of the article; E.S. Ruchko — obtaining and cultivation of 3D cell cultures, writing the text and editing of the article; A.S. Pikina — performing and analysis of quantitative PCR data, writing and editing of the article; A.A. Barinova — staging of ICR, writing and editing of the article; A.V. Eremeev — experimental supervision, writing and editing of the article. All authors approved the manuscript (version for publication) and agreed to take responsibility for all aspects of the work, ensuring the proper consideration and resolution of any issues related to the accuracy and integrity of any part of the study.

Acknowledgments. The authors thank A.N. Bogomazova for her help in editing the manuscript.

Ethics approval. The study was approved by the Local Ethics Committee of the Lopukhin Federal Research and Clinical Center of Physical-Chemical Medicine of Federal Medical Biological Agency (Protocol No. 2019/02 dated 2019 April 9). All study participants signed an informed consent form prior to inclusion in the study.

Consent for publication. The authors obtained written informed consent from the patients, in a form approved by the Local Ethics Committee of the Lopukhin Federal Research and Clinical Center of Physical-Chemical Medicine of Federal Medical Biological Agency, for the publication of personal data in a scientific journal, including its electronic version. The scope of the published data was agreed upon with the patients.

Funding source. The research was supported with an allocation No. 22-15-00250 by the Russian Science Foundation.

Disclosure of interests. The authors have no relationships, activities or interests for the last three years related with for-profit or not-for-profit third parties whose interests may be affected by the content of the article.

Statement of originality. In the preparation of this work, the authors did not use any previously published information (text, illustrations, or data).

Data availability statement. All data obtained in this study are available in the article.

Generative AI. No generative artificial intelligence technologies were used in the preparation of this article.

Provenance and peer-review. This work was submitted to the journal on the authors’ initiative and underwent the standard review process. The manuscript was reviewed by one member of the editorial board, two external reviewers and the journal’s scientific editor.

About the authors

Evgenii S. Ruchko

Lopukhin Federal Research and Clinical Center of Physical-Chemical Medicine of Federal Medical Biological Agency

Author for correspondence.
Email: Ruchkoevgeny@yandex.ru
ORCID iD: 0000-0002-1361-666X
SPIN-code: 7220-6031
Russian Federation, Moscow

Polina A. Golubinskaya

Lopukhin Federal Research and Clinical Center of Physical-Chemical Medicine of Federal Medical Biological Agency

Email: polinapigeon@gmail.com
ORCID iD: 0000-0002-1765-9042
SPIN-code: 5299-9693

MD, Cand. Sci. (Medicine)

Russian Federation, Moscow

Arina S. Pikina

Lopukhin Federal Research and Clinical Center of Physical-Chemical Medicine of Federal Medical Biological Agency

Email: arina.pikina@yandex.ru
ORCID iD: 0000-0002-8967-2318
SPIN-code: 8654-7318
Russian Federation, Moscow

Anna A. Barinova

Lopukhin Federal Research and Clinical Center of Physical-Chemical Medicine of Federal Medical Biological Agency

Email: barinova.anna.al@mail.ru
ORCID iD: 0009-0001-1212-8154
SPIN-code: 1955-4313
Russian Federation, Moscow

Artem V. Eremeev

Lopukhin Federal Research and Clinical Center of Physical-Chemical Medicine of Federal Medical Biological Agency

Email: art-eremeev@yandex.ru
ORCID iD: 0000-0002-3428-7586
SPIN-code: 4825-5440

Cand. Sci. (Biology)

Russian Federation, Moscow

References

Supplementary files