Поиск Кабинет

Влияние Плуроника Р85 на пролиферацию и остеогенную дифференциацию мезенхимных стволовых клеток человека in vitro

Гены & Клетки: Том V, №3, 2010 год, стр.: 66-70

 

Авторы

Блатт НЛ., Ялвач М.Э., Шафигуллина А.К., Салафутдинов И.И., Киясов А.П., Масгутов Р.Ф., Штырлин Ю.Г., Кабанов А.В., Ризванов АА.

ДЛЯ ТОГО ЧТОБЫ СКАЧАТЬ СТАТЬЮ В ФОРМАТЕ PDF ВАМ НЕОБХОДИМО АВТОРИЗОВАТЬСЯ, ЛИБО ЗАРЕГИСТРИРОВАТЬСЯ

Исследовано влияние неионного блок-сополимера (Плуроника) Р85 на пролиферацию и остеогенную дифференциацию мезенхимных стволовых клеток (МСК) человека in vitro.

Показано, что в концентрациях 0,1—1% Плуроник Р85 оказывает цитотоксический эффект на МСК. При концентрациях Плуроника Р85 0,001—0,01% происходило повышение пролиферации МСК. Инкубация МСК с Плуроником Р85 повышала эффективность дифференциации клеток в остеогенном направлении.

Полимерные наноносители привлекают внимание исследователей в качестве векторов для доставки лекарственных средств. Один из перспективных классов полимеров — неионные полиэфирные блок-сополимеры (Плуроники). Достигнут значительный прогресс в области применения Плуроников для доставки лекарственных средств[1]. Известно, что Плуроники обладают широким спектром биологических активностей. Один из перспективных полимерных наноносителей — Плуроник Р85, триблок-сополимер этилен оксида CEOD и пропилен оксида (РО) Е02В-Р040-Е028. Показано, что Плуроник Р85 ингибируют механизмы множественной лекарственной резистентности (MDR), повышая эффективность противораковой терапии[2, 3]. Кроме того, недавно было показано, что внутримышечное введение мышам Плуроника Р85 совместно с плаз-мидной ДНК существенно повышало эффективность прямой генной терапии[4].

Несмотря на достигнутый прогресс, влияние Плуроников на биологические свойства стволовых клеток человека остается малоизученным. Взаимодействие Плуроников в составе разрабатываемых лекарственных препаратов со стволовыми клетками организма может оказывать опосредованное влияние на регенерационный потенциал. В связи с этим целью нашей работы стало исследование влияния Плуроника Р85 на пролиферацию и дифференциацию МСК человека.

Материалы и методы

МСК выделили из третьего моляра человека (зуб мудрости) как описано ранее[5]. Непрорезавшиеся три третьих моляра человека удалили хирургическим методом у здоровой пациентки (20 лет) в профилактических целях. Пульпу зуба извлекли в асептических условиях, разрезали на мелкие кусочки стерильным скальпелем и поместили в культуральную среду Alpha modified Minimum Essential Medium (—MEM) с добавлением 10% эмбриональной телячьей сыворотки (FBS), пенициллина-стрептомицина (все реагенты для культур клеток фирмы ПанЭко, Москва). После 10 дней инкубации при 37°С в влажной атмосфере с содержанием 5% С02 клетки образовывали монослой. Культуральную среду меняли каждые 2 дня. В экспериментах использовали клетки 4—5 пассажа.

Неионный блок-сополимер Плуроник Р85 (Basf) добавляли в культуральную среду в конечной концентрации от 0,0001% до 1% (вес/объём). Пролиферацию клеток определяли колориметрически с помощью реагента MTS (Promega) на планшетном анализаторе CERES 900HDi (Bio-Tek Instruments, Inc.) через 24 и 72 ч после добавления Плуроника Р85.

Для остеогенной дифференциации клетки высевали на 96- или 6-луночные плашки в концентрации 3000 клеток/см2. На следующий день к клеткам добавляли Плуроник Р85 в конечной концентрации 0,01%. После инкубации в течение 24 ч культуральную среду заменили на среду Dulbecco’s modified essential medium (DMEM, ПанЗко, Москва) с добавлением 10% эмбриональной телячьей сыворотки (FBS), пенициллина-стрептомицина, 0,1 мМ дексаметазона (Sigma-Aldrich Co.), 10 мМ в-глицерол-фосфата (Sigma-Aldrich Co.), 50 мМ аскорбата (Sigma-Aldrich Co.). Культуральную среду меняли каждые 2 дня. Кальцифицированные костные образования окрашивали методом von Kossa. Активность щелочной фосфатазы определяли колориметрически с помощью субстрата ALK Phosphatase opt. Substrate АР542 (RANDOX) в соответствии с инструкциями производителя на планшетном анализаторе CERES 900HDi (Bio-Tek Instruments, Inc.).

Общую РНК из клеток выделяли с помощью набора High Pure RNA Isolation Kit (Roche), синтез кДНК осуществляли с использованием набора Omniscript Reverse Transcriptase Kit (Qiagen) согласно инструкциям фирм-производителей. Для количественной оценки экспрессии генов-мишеней в работе применяли ПЦР в реальном времени (ПЦР-РВ) с использованием набора реагентов SYBR Premix Ex Taq (TaKaRa) на приборе iCycler RT-PCR detection system (Bio-Rad). Праймеры для ПЦР-РВ: GAPDH (прямой: TAT CGT GGA AGG ACT CA, обратный: GCA GGG ATG ATG TTC TGG A)[6]; остео-нектин (прямой: 5'ATG AGG GCC TGG АТС TTC TT 3', обратный: 5' CTGCTTCTCAGTCAGAAGGT 3')[7].

Все эксперименты проводились в трипликатах. Статистический анализ проводили методом t-критерия Стьюдента в программе Excel 2007.

Результаты и обсуждение

Ранее нами было показано, что клетки, полученные из пульпы третьих моляров человека, обладают всеми характеристиками МСК: способны к дифференциации в остеогенном, хондрогенном и адипоген-ном направлении, экспрессируют характерные для МСК поверхностные антигены (CD29 + , CD73 + , CD90 + , CD105 + , CD14-, CD34-, CD44-, CD45-, CD133~, CD166") и высокий уровень факторов транскрипции, играющих ключевую роль в поддержании клеток в дедифференцированном состоянии isox2, c-myc, klf4)[8, 9].

Культуру клеток МСК инкубировали с Плурони-ком Р85 в течение 24 и 72 ч. Морфологический анализ МСК через 24 часа показал, что в концентрации 1 % Плуроник Р85 оказывает выраженное цитотокси-ческое действие, в концентрации 0,1% существенно влияет на морфологию клеток и не оказывает значительного влияния на морфологию МСК в концентрации 0,01% (рис. 1). Анализ жизнеспособности клеточных культур с помощью MTS-теста подтвердил цитотоксическое действие Плуроника Р85 в концентрациях 0,1—1% (рис. 2).

Концентрации Плуроника Р85 0,0001^0,01% не приводили к гибели клеток. Интересно, что в концентрациях Плуроника Р85 0,001^0,01% мы наблюдали значительное увеличение жизнеспособности клеточных культур (42^50% соответственно) через 72 ч инкубации, что, по-видимому, связано с повышением пролиферации стволовых клеток.

Далее мы исследовали влияние Плуроника Р85 на остеогенную дифференциацию МСК. Для этого мы инкубировали клетки с Плуроником Р85 в конечной концентрации 0,01%, показавшей наивысший стимулирующий эффект на пролиферацию МСК. Через 24 ч инкубации, среду заменили на остеогенную. Через 7 дней дифференциации мы наблюдали формирование кальцифицированных структур, окрашиваемых методом von Kossa (рис. 3).

Экспрессия щелочной фосфатазы — один из маркеров клеточной дифференцировки в остеогенном направлении[10]. Определение активности фермента с помощью колориметрического метода показало, что активность щелочной фосфатазы в клетках, предварительно обработанных Плуроником Р85 в концентрации 0,01% в течение 24 ч с последующим инкубированием в дифференцировочной среде в течение 7 дней, статистически выше, чем в контрольной клеточной культуре (рис. 4А). Также наблюдалось значительной увеличение уровня экспрессии мРНК гена остеонектина (рис. 4Б). Остеонектин — гликопротеин, секретируемый остеобластами и участвующий в минерализации костной ткани[11].

Таким образом, впервые показано, что добавление Плуроника Р85 оказывает стимулирующий эффект на пролиферацию мезенхимных стволовых клеток человека. Кроме того, впервые показано, что предварительная инкубация Плуроника Р85 повышает эффективность остеогенной дифференциации МСК. Полученные данные могут быть применены в тканевой инженерии при экспансии МСК ex vivo с последующей дифференци-ровкой в остеогенном направлении.

Подняться вверх сайта