Поиск Кабинет

Эффективность и механизм противоопухолевой активности липоплексов кардиолипиноподобного липида и гена тимидинкиназы HSV-tk в присутствие ганцикловира

Гены & Клетки: Том VII, №3, 2012 год, стр. 116-120

 

Авторы

Московцев А.А, Соколовская А.А., Ибрагимова М.Я., Дойникова А.Н., Себякин Ю.Л., Жданов Р.И.

ДЛЯ ТОГО ЧТОБЫ СКАЧАТЬ СТАТЬЮ В ФОРМАТЕ PDF ВАМ НЕОБХОДИМО АВТОРИЗОВАТЬСЯ, ЛИБО ЗАРЕГИСТРИРОВАТЬСЯ

Система тимидинкиназы вируса простого герпеса/ганцикловир (HSV-tk/GCV) исследована в составе липоплексов на основе дикатионного кардиолипиноподобного липида КДЛ-I. Она предложена в качестве невирусной системы для использования в протоколах генотерапии онкологических заболеваний. Ранее на культурах опухолевых клеток MCF7 и HEC293 была показана эффективная трансфекция клеток этими бисамфифилами. Невирусная система на основе липоплекса дикатионного КДЛ-I/HSV-tk и ганцикловира эффективно вызывает гибель опухолевых клеток с вовлечением ключевых стадий апоптоза. Деполяризация митохондриальной мембраны обнаружена также при использовании липоплексов дикатионного липида КДЛ-I в экспрессирующих тимидинкиназу клетках в ответ на ганцикловир и активацию фактора NF-kB. Предполагается раннее вовлечение митохондриального пути апоптоза также и в механизм действия «суицидальных» липоплексов дикатионного липида.

В последние годы предпринимаются успешные попытки восстановить нормальное функциональное состояние ткани при патогенезе методами генной терапии [1–4]. Возрастающее внимание уделяется использованию в протоколах генотерапии невирусных систем трансфекции, которые, по сравнению с вирусными системами, не имеют жестких ограничений размера генетических конструкций [5–9]. В частности, при первом использовании невирусного переноса генов in vivo у человека с помощью липосом DC-Chol: DOPE с геном HLA B7 у всех исследуемых пациентов с меланомой была обнаружена экспрессия этого гена [10]. Недостатком всех невирусных методов переноса генов является непродолжительное время экспрессии, невысокая эффективность, ограниченная эндосомно-лизосомальной деградацией, а также отсутствие тканеспецифичности [5, 8].

Среди клеточных реакций, участвующих в ингибировании опухолеобразования, одной из наиболее изучаемых и важных клеточной реакцией в настоящее время является апоптоз [11]. Система тимидинкиназа вируса простого герпеса первого типа / ганцикловир (HSV-tk/GCV) («suicide gene»), применяемая в ряде клинических протоколов генной терапии, способна запускать в клетках опухоли процессы, приводящие к их гибели, среди которых важное место занимает апоптоз [12–17]. Целью работы является оценка эффективности и исследование механизма противоопухолевого действия нового липоплекса на основе дикатионного кардиолипиноподобного липида КДЛ-I и плазмиды pUT649, кодирующей ген HSV-tk, после применения ганцикловира на линиях опухолевых клеток по сравнению с липоплексами на основе монокатионных липидов.

Материал и методы

Кардиолипиноподобный дикатионный липид КДЛ-I синтезирован, как описано ранее [18], и его строение подтверждено совокупностью данных элементного анализа, 1Н-ЯМР- и ИК-спектроскопии, а также масс-спектрометрии. Структура кардиолипиноподобного липида – КДЛ-I (m = 3) приведена в нашей предыдущей работе [19].

Культуры клеток. Исследования проводились in vitro на культурах клеток MCF-7 и HEK293. Клетки получены из Российской коллекции культур клеток позвоночных (Институт цитологии РАН). Все клетки паспортизованы, прошли контроль видовой специфичности (во всех случаях проведен кариотипический анализ) и контроль контаминации (бактерии, грибы и микоплазма не обнаружены) [17]. Клетки культивировали на среде DMEM c 10% FBS (GibcoTM Invitrogen Corporation) в атмосфере 5% СО2. MCF-7 и HEK293 снимали с культуральных матрасов и пересаживали в 96-луночную плашку с исходной плотностью 104 клетки на лунку в ростовую среду [7].

Трансфекция. Через 24 ч культуру клеток (96-луночная плашка, плотность 104 клетки/лунку, DMEM и 10% FBS) промывали бессывороточной средой и добавляли липоплексы в бессывороточной среде. Клетки инкубировали 6 часов при 37°С и 5% СО2, затем среду заменяли на полную ростовую. Для трансфекции использовали липоплексы на основе кардиолипиноподобного дикатионного липида КДЛ-I и плазмиды pUT649 с геном тимидинкиназы HSV-tk (Cayla, ZI Montaudran – BP4437, France), полученные как описано ранее [17].

В качестве контроля в исследованиях трансфекции использовали Lipofectin®Reagent (смесь катионных липидов DOTMA и DOPE, w/w 1:1, Invitrogen Corporation, U.S.A.). Для индукции гибели трансфицированных HSV-tk позитивных клеток добавляли противовирусный препарат ганцикловир. Селекцию трансфицированных клеток проводили с помощью антибиотика Zeocin (Cayla, France – InVivoGen, USA.) с постепенным увеличением его концентрации до 100 мкг/мл. Продолжительность селекции была в среднем 3,5 нед.

Регистрация экспрессии гена HSV-tk клетками методом RT-PCR. На первом этапе из клеток MCF-7 и HEK293 выделяли тотальную РНК (наборы «MBI Fermentas», Вильнюс, Литва). Экспрессия мРНК генa HSV-tk тимидинкиназы вируса простого герпеса первого типа была подтверждена с помощью RT-PCR с применением пары праймеров (sense: 5’ GCTGCTTGCAATACGGTGCG-3’; antisense: 5’ CGCAGATCGTCGGTATGGAGCC-3’).

Получение и цифровой анализ видеоизображений флуоресцентной и конфокальной микроскопии. Статическую, цейтраферную микросъемку производили на флуоресцентном микроскопе Zeiss Axioskop 20 с помощью видеосистемы на базе цветной интегрирующей 3-х матричной (3CCD) камеры Sony, видеозахват и оцифровку – с помощью фреймграббера Matrox Meteor [7]. Конфокальную лазерную сканирующую микроскопию выполняли на инвертированном микроскопе Nikon Eclipse TE 2000, оснащенном контрастом Хоффмана и конфокальным модулем C1 с лазерами 488 и 543 нм. Для цифровой обработки изображений использовалось программное обеспечение KS100 (Zeiss), MS Office 2010, Ulead Media Studio, Image Pro Plus (Media Cybernetics), для трехмерной реконструкции – EZ-C1 v2.30 (Nikon). Детекция деполяризации митохондриальной мембраны производилась с помощью зонда JC-1 как описано ранее [20, 21].

Активация фактора транскрипции NF-kB (p65). Определение активации транскрипционного фактора NF-kB (p65) в ответ на действие системы HSV-tk производили с помощью методики и тестсистемы NoShift Transcription Factor Assay Kit (EMD Biosciences, Inc, an affiliate of Merck KGaA, Germany) как описано ранее [22]. Технология обеспечивает быструю и чувствительную детекцию транскрипционных факторов или других белков, связывающихся с ДНК и основан на колориметрии в планшете. Активированные ДНК-связывающие белки локализуются в ядре клеток, поэтому для анализа экстрагировали белки ядра клеток с помощью NucBuster Protein Extraction Kit (EMD Millipore Bioscience).

Статистическая обработка результатов производилась с помощью программного обеспечения Statistica ver.6.0 (StatSoft Inc, U.S.A.), а также Microsoft Excel. Использовались однофакторный дисперсионный анализ и критерий Крускала-Уоллиса. Различия считались достоверными при p < 0,05.

Результаты и обсуждение

Цитотоксическое действие комплекса «КДЛ-I –pUT649/GCV». Цитотоксическое действие комплекса «КДЛ-I – pUT649/GCV» спустя 48 ч. после добавления в среду культивации ганцикловира было зарегистрировано нами с помощью МТТ-теста. Оно заключалось в существенном уменьшении количества жизнеспособных клеток как MCF7, так и HEK293. Была отмечена корреляция концентрации ганцикловира с выраженностью цитотоксического эффекта: доля выживших клеток уменьшалась с увеличением GCV от 0,1 к 1,0 и до 5 мкг/мл: для MCF7 доля 42,03; 28,45; и 24,76%., и для HEK293 – 61,10; 35,23; и 29,01%. Высокий процент клеточной гибели (до 75% для MCF7 и до 71% для НЕК293) на фоне сравнительно невысокой эффективности трансфекции, возможно, обусловлен так называемым эффектом летального соседства (bystander effect), характерным для «суицидной» системы HSV-tk/GCV [13, 16].

Экспрессия мРНК тимидинкиназы вируса простого герпеса первого типа. Селекция трансфицированных pUT649 клеток с целью обогащения популяции HSV-tk -положительными клетками стала возможна благодаря тому, что продукт экспрессии представляет собой рекомбинантный белок – тимидинкиназу, конъюгированную с продуктом экспрессии Sh ble гена (375 п.о.) – небольшим белком – Sh ble protein (м.м. 13665 Дa), обладающим высокой афинностью к антибиотикам флеомицинового ряда (в частности, Zeocin) и тем самым сообщающим устойчивость трансфицированным клеткам. Экспрессия гена HSV-tk была подтверждена нами методом RT-PCR с применением пары праймеров: -sense: 5’GCTGCTTGCAATACGGTGCG3’; -antisense: 5’CGCAGATCGTCGGTATGGAGCC-3’. Для обеих культур клеток MCF7 и HEK293, трансфицированных геном HSV-tk, была зарегистрирована полоса на электрофореграмме размером 368 п.о. Это свидетельствует об экспрессии мРНК гена тимидинкиназы вируса простого герпеса первого типа (ее не было в контрольных клетках без HSV-tk/GCV).

Кинетика деполяризации митохондриальной мембраны при действии системы HSV-tk/GCV. Деполяризация митохондриальной мембраны свидетельствует о вовлечении митохондрий в индуцированный повреждением каскад клеточных реакций [22]. Для проверки, имеет ли она место в случае системы липоплекса дикатионного липида КДЛ-I/HSV-tk, а не только для липоплексов монокатионных липидов, использовали конфокальную лазерную сканирующую микроскопию клеток MCF7, прошедших селекцию как HSV-tk позитивных и обработанных ганцикловиром, так и контрольных, нетрансфицированных. Для детекции трансмембранного потенциала митохондриальной мембраны использовали флуоресцентный краситель JC-1, обладающий высоким сродством к митохондриям и способностью к спектральному сдвигу эмиссии с 527 нм в мономерной форме (зеленая флуоресценция) при снижении потенциала и деполяризации до 590 нм (оранжево-красная) при образовании J-агрегатов (рис. А–П). Полученные данные позволяют утверждать, что в ответ на действие системы дикатионного липида и гена HSV-tk в клетках MCF7 развивается деполяризация митохондриальной мембраны, начиная с 6 часов после начала инкубации с ганцикловиром (рис. А–И). Из данных рисунка, а именно: значительного усиления зеленого окрашивания от поля К к полю Н – следует, что в ответ на действие системы HSV-tk в клетках MCF7 имеет место деполяризация митохондриальной мембраны спустя 24 ч после начала инкубации с ганцикловиром. Это говорит о вовлечении митохондриального каскада в цепь событий, являющихся реакцией клетки на действие системы HSV-tk/GCV.

Определение активации транскрипционного фактора NF-kB (p65). В клетках MCF7 при действии системы HSV-tk/GCV спустя 24 ч после добавления ганцикловира в среду культивации было обнаружено также повышение содержания фактора транскрипции NF-kB. Это определялось по увеличению оптической плотности (табл.). Первые 4 строки являются контролями: без ганцикловира отличий нет. В его присутствии содержание фактора NF-kB возрастает в 3–4 раза как в присутствии специфических и неспецифических полинуклеотидов, конкурентно взаимодействующих с фактором.

Таким образом, обнаруженные клеточные ответы в виде деполяризации митохондриальной мембраны и активации NF-kB позволяют предположить комплексное действие системы HSV-tk/GCV, индуцирующее каскад реакций, ведущий к клеточной гибели. Помимо классического p53-опосредованного пути в ответ на повреждение ДНК, имеющего место при действии HSV-tk [12–16], можно предположить подключение дополнительных стимулов, например, связанных с возможным нарушением репарации ядерной ДНК, синтеза митохондриальной ДНК (ядерно-митохондриальное взаимодействие). Каждый из этих сигналов может быть подпороговым и недостаточным для принятия клеткой решения о самоубийстве, но интегральной суммы сигналов может хватить для исполнения апоптоза [17, 18]. С этой точки зрения повреждение ядерной ДНК может являться основной (но не единственной) причиной апоптоза. Известно, что транскрипционный фактор NFκB влияет на регуляцию апоптоза по нескольким механизмам [22]. Предполагается, что NFκB кооперирует с р53, регулируя некоторые гены, необходимые для индукции апоптоза, в частности, рецептор клеточной смерти KILLER/DR5 [22]. Этот факт свидетельствует о неспецифическом модулировании этим транскрипционным фактором апоптотического каскада, так как значительное количество промоторов содержит сайты связывания с NF-kB.

Выводы

1. Предложенная новая невирусная система на основе дикатионного липида КДЛ-I, HSVtk и ганцикловира эффективно вызывает гибель опухолевых клеток с вовлечением ключевых стадий апоптоза.

2. В случае генного переноса липоплексом на основе дикатионного липида обнаружена деполяризация митохондриальной мембраны и повышенный уровень фактора NF-kB в экспрессирующих тимидинкиназу клетках в ответ на ганцикловир.

Подняться вверх сайта